View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3063_low_57 (Length: 202)
Name: NF3063_low_57
Description: NF3063
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3063_low_57 |
 | |
|
| [»] scaffold0110 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 45125824 - 45125993
Alignment:
| Q |
16 |
caagaggcattccatcactattaagagtgcatgattgtgggtcagatccatcagggctcaacatcaaagcacgaagaacccaagtaactgtgtgaatgta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45125824 |
caagaggcattccatcactattaagagtacatgattgtgggtcagatccatcagggctcaacatcaaagcacgaagaacccaagtaactgtgtgaatgta |
45125923 |
T |
|
| Q |
116 |
agttgtcctattcttagcaagaagccatgttaatcccattagttcacaatctttgttatggatcttggtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45125924 |
agttgtcctattcttagcaagaagccatgttaatcccattagttcacaatctttgttatggatcttggtt |
45125993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 5422 - 5259
Alignment:
| Q |
18 |
agaggcattccatcactattaagagtgcatgattgtgggtcagatccatcagggctcaacatcaaagcacgaagaacccaagtaactgtgtgaatgtaag |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| | ||||||||| | |||||| ||||||||||||||| |||||| |||||||| |||| |
|
|
| T |
5422 |
agaggcattccatcactatttagagtgcatgattgtggtttagatccatctttgttcaacaacaaagcacgaagaacgttagtaaccgtgtgaatataag |
5323 |
T |
|
| Q |
118 |
ttgtcctattcttagcaagaagccatgttaatcccattagttcacaatctttgttatggatctt |
181 |
Q |
| |
|
|||| |||||| | ||||||||||| || |||||||| |||||||||||||| || ||||| |
|
|
| T |
5322 |
ccgtccgattcttcgacagaagccatgtcaagcccattagctcacaatctttgttgtgaatctt |
5259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University