View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_high_26 (Length: 338)
Name: NF3064_high_26
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 186 - 330
Target Start/End: Original strand, 13289280 - 13289430
Alignment:
| Q |
186 |
aaaattggattggttcagaattaattgacgatcttataagttataactcttcaaaattcaggattgagacttcaagatgagtgaggtcccctcaga---- |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13289280 |
aaaattggattggttcagaattaattgacgatcttataagttataactcttcaaaattcaggattgagacttcaagatgagtgaggtcccctcagaattg |
13289379 |
T |
|
| Q |
282 |
--acctcgttatgttcccttgattgatcttgaggacagtgatgatgatgtc |
330 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13289380 |
agacttcgttatgttcccttgattgatcttgaggatagtgatgatgatgtc |
13289430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 19 - 118
Target Start/End: Original strand, 13289112 - 13289211
Alignment:
| Q |
19 |
tcccaagccacatagacaactaattcattcaaactcactagctattctgtatattttctcacctctatgtagtttctgcatgaattcaaattctaatgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13289112 |
tcccaagccacatagacaactaattcattcaaactcactagctattctgtatattttctcacctctatgtagtttttgcatgaattcaaattctaatgtg |
13289211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University