View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_high_35 (Length: 296)
Name: NF3064_high_35
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 23227171 - 23226899
Alignment:
| Q |
18 |
agaaagcttcagaatctttagacccaataaccctctcatacttagctctcatatacatgagctcaccttcaaactcacctccattcccactacttggcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23227171 |
agaaagcttcagaatctttagacccaataaccctctcatacttagctctcatatacatgagctcaccttcaaactcacctccattcccactacttggcat |
23227072 |
T |
|
| Q |
118 |
tggcaacacaccagcacccattgaaataggttcgacagctttcaatatcttccattcctctgatccacattcatgcctataagcataaccacattttctt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23227071 |
tggcaacacaccagcacccattgaaataggttccacagctttcaatatcttccattcctctgatccacattcatgcctataagcataaccacattttctt |
23226972 |
T |
|
| Q |
218 |
ccattacaataagacctccaaattggttcctcaagcaacttcaaactctttctccctcctcctttcttctcac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23226971 |
ccattacaataagacctccaaattggttcctcaagcaacttcaaactctttctccctcctcctttcttctcac |
23226899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 118 - 167
Target Start/End: Complemental strand, 46089769 - 46089720
Alignment:
| Q |
118 |
tggcaacacaccagcacccattgaaataggttcgacagctttcaatatct |
167 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
46089769 |
tggcaaaacaccagcacccattgaaataggctcaacagctttcaaaatct |
46089720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 46089860 - 46089803
Alignment:
| Q |
18 |
agaaagcttcagaatctttagacccaataaccctctcatacttagctctcatatacat |
75 |
Q |
| |
|
||||||||||||||||| |||| |||| || |||||| || |||||||||||||||| |
|
|
| T |
46089860 |
agaaagcttcagaatctctagagccaacaattctctcaaacctagctctcatatacat |
46089803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University