View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_high_42 (Length: 264)
Name: NF3064_high_42
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 60 - 247
Target Start/End: Complemental strand, 6365731 - 6365544
Alignment:
| Q |
60 |
ttatttatgtaatgagccagcttatattacccatcttcatttaaacgtgttgttatttagtaaattaattatgtaaaaaacatataataatgaacaataa |
159 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6365731 |
ttatttatgtaatgtgccagcttatattacccatcttcatttaaatgtgttgttatttagtaaattaattatgtaaaaaacatataataatgaacaataa |
6365632 |
T |
 |
| Q |
160 |
acaattatttcttttgaactaaccttgcacctatcaactactataaatactaagcatccccttggtaacaaaacacaagcttttcttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6365631 |
acaattatttcttttgaactaaccttgcacctatcaactactataaatactaagcatccccttggtaacaaaacacaagcttttcttt |
6365544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University