View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_high_56 (Length: 237)
Name: NF3064_high_56
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_high_56 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 85
Target Start/End: Complemental strand, 30013794 - 30013753
Alignment:
| Q |
44 |
taaaagattaattttgtttataataatgatcggatggtgtat |
85 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
30013794 |
taaaaggttaattttgtttataataatgatcggatggggtat |
30013753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University