View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_high_57 (Length: 232)
Name: NF3064_high_57
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 47590746 - 47590535
Alignment:
| Q |
1 |
aattgaattggtgaaattttggagcacttgtatcaatacgtgaaaggagagaatgataggaatatcggagtaaacatttatcgtaccaaattatagcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47590746 |
aattgaattggtgaaattttggagcacttgtatcaatacgtgaaaggagagaatgataggaatagcggagtaaacatttatcgtaccaaattatagcctc |
47590647 |
T |
|
| Q |
101 |
tttggaggaagggcactccgataatattctttttgttgcatgttggatacatagctgacagagggtaggggagatggagatatcaccacggctcataaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47590646 |
tttggaggaagggcactccgataatattctttttgttgcatgttggatacatagctgacagagggtaggggagatggagatatcaccacggcacataaag |
47590547 |
T |
|
| Q |
201 |
agaccattggca |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47590546 |
agaccattggca |
47590535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University