View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_1 (Length: 663)
Name: NF3064_low_1
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 318 - 651
Target Start/End: Complemental strand, 41084774 - 41084441
Alignment:
| Q |
318 |
caaagttggtcgcgatatagaggatttgataggcatgagcgggtctctgatgttgtgagggagaagaagaggtcggcgtcacatctctatagacgatgac |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41084774 |
caaagttggtcgcgatatagaggatttgataggcatgagcggatatctgatgttgtgagggagaagaagaggtcggcgtcacatctctatagacgatgac |
41084675 |
T |
|
| Q |
418 |
gacatgatgtcgtcggcgtgacaaatgagtttgtcggcgtgagagtggaggttgtgttgcagacgaggtaaaattcaggttgattcaatacatatcgagc |
517 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41084674 |
gacatgatgtcgtcggcgtgacaaatgagtttgtcggcttgagagtggaggttgtgttgcagatgaggtaaaattcaggttgatccaatacatatcgagc |
41084575 |
T |
|
| Q |
518 |
taagtcaaattaaataaaattcaactaagcttgattcatatttacatcttcacataaaaactttaaggcattatatacgagttttctcatttatatgatg |
617 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41084574 |
taagtcaaattaaataaaattcaactaagcttgattcatatttacatcttcacataaaaactttaaggcattatatacgagttttctcatttatacgatg |
41084475 |
T |
|
| Q |
618 |
cttacatccacatttttaggaccgccccaatatt |
651 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41084474 |
cttacatccacatttttaggaccgccccaatatt |
41084441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 7e-57
Query Start/End: Original strand, 34 - 158
Target Start/End: Complemental strand, 41085054 - 41084930
Alignment:
| Q |
34 |
tgtcatatttacacttcgtatcaaaagcaatcttggccattatgaattcatagacatccttttttcaaacacccaatatacaccccacgtgtcattatgg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
41085054 |
tgtcatatttacacttcgtatcaaaagcaatcgtggccattatgaattcatagacatccttttttcaaacccccaatatacaccccacgtgtcattaggg |
41084955 |
T |
|
| Q |
134 |
ctattttggtgatttcaccttaccc |
158 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41084954 |
ctattttggtgatttcaccttaccc |
41084930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 199 - 253
Target Start/End: Complemental strand, 41084889 - 41084835
Alignment:
| Q |
199 |
aacaccaccaccaccgtgtgtttaggttttcttatttccttgttgcagatttgcg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41084889 |
aacaccaccaccaccgtgtgtttaggttttcttatttcgttgttgcagatttgcg |
41084835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University