View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_28 (Length: 327)
Name: NF3064_low_28
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 316
Target Start/End: Complemental strand, 40753829 - 40753527
Alignment:
| Q |
16 |
ctatcctcatttttgtatcaaaataataaatgaggttttttagtagaaaattgtgtatctgaaaagatgtttttt--aagtagaaaagtgtgtacttcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40753829 |
ctatcctcatttttgtatcaaaataataaatgaggttttttagtagaaaattgtgtatctgaaaagatgttttttttaagtagaaaagtgtgtacttcaa |
40753730 |
T |
|
| Q |
114 |
taatctttatagtgaggattttaaacccgtctaaaccatatccggacaactgtattggagaaacacttatgtgtcaaataagatagccttgtatcaaaca |
213 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||| |||||||||||| || |||||||||||||||| |||||||| |
|
|
| T |
40753729 |
taatctttatagtgagggtttttaacccgtctaaaccatatccggacaactgtcttggggaaacacttatgagttaaataagatagccttggatcaaaca |
40753630 |
T |
|
| Q |
214 |
tggacaatccatattagcttattcggccttgattcggtaaatttagggcaagaccgagtcatcgttcatgagtgtgctagtgacttcagatgtcccgatc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||||||||||| || || ||||||| |
|
|
| T |
40753629 |
tggacaatccatattagcttattcggccttgattcagtagatttagggcaagaccgagtcatcgttcgtgagtgtgctagtgacttgaggtgacccgatc |
40753530 |
T |
|
| Q |
314 |
cat |
316 |
Q |
| |
|
||| |
|
|
| T |
40753529 |
cat |
40753527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University