View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_34 (Length: 296)
Name: NF3064_low_34
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 9165968 - 9166196
Alignment:
| Q |
19 |
atccaagctctactcaagtcttgcgagcttatcggtctttcacttttaacagatttttgtgttagacaacttttaaacaatgtgttctcagattgtccta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
9165968 |
atccaagctctactcaagtcttgcgagcttatcggtctttcacttttaacagatttttgtgttagataacttttaaacaatatgttctcagattgtccta |
9166067 |
T |
 |
| Q |
119 |
ttagcagttttataatgtatatggtnnnnnnnttgttccctgcatgaaactaaccaaaagtaaattggtaaccttcaacatggattcataaatataaaac |
218 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166068 |
ttagcagttttatgatgtatatggtaaaaaaattgttccctgcatgaaactaaccaaaagtaaattggtaaccttcaacatggattcataaatataaaac |
9166167 |
T |
 |
| Q |
219 |
aaacaaggcaagatactcacccttttcaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9166168 |
aaacaaggcaagatactcacccttttcaa |
9166196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 151 - 247
Target Start/End: Original strand, 9154691 - 9154791
Alignment:
| Q |
151 |
ttgttccctgcatgaaactaaccaaaagtaaattggtaaccttcaacatggattcat----aaatataaaacaaacaaggcaagatactcacccttttca |
246 |
Q |
| |
|
|||||| || ||| |||||||| | ||||||| || ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9154691 |
ttgttcactacataaaactaactagaagtaaactgataaccttcaacatggattcatgaaaaaatataaaacaaacaaggcaaaatactcacccttttca |
9154790 |
T |
 |
| Q |
247 |
a |
247 |
Q |
| |
|
| |
|
|
| T |
9154791 |
a |
9154791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University