View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_36 (Length: 294)
Name: NF3064_low_36
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 14 - 278
Target Start/End: Complemental strand, 869439 - 869175
Alignment:
| Q |
14 |
aagaatggtatcagctgttgagagattagaggagctagttgtttactgccctttctctgtgtatggccttgcttcatggctatcacttgcaggtccgtct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869439 |
aagaatggtatcagctgttgagagattagaggagctagttgtttactgccctttctctgtgtatggccttgcttcatggctatcacttgcaggtccgtct |
869340 |
T |
|
| Q |
114 |
ctctctcatctggagcttcgaatggacaaccttggcgataatgagattatacatgaaagcccatcaaagttggattgcattggtgcagcagtcaatgtgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869339 |
ctctctcatctggagcttcgaatggacaaccttggcgataatgagattatacatgaaagcccatcaaagttggattgcattggtgcagcagtcaatgtgg |
869240 |
T |
|
| Q |
214 |
aaactctaaaattgtggggtgtcttgatcaaacttatccctaaatgggaaacgttccataatctt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
869239 |
aaactctaaaattgtggggtgtcttgatcaaacttatccctaaatgggaaacgttccataatctt |
869175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University