View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_45 (Length: 254)
Name: NF3064_low_45
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 94 - 244
Target Start/End: Complemental strand, 21774289 - 21774139
Alignment:
| Q |
94 |
ttacctaatgccatgaccagggccacaagcaatacgatcaatccacacatgagttgtaccctgatttatggatatgcaatcatcaccagtcattatagtg |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21774289 |
ttacctaatgccatgaccagggccacatgcaatacgatcaatccacacatgagttgtaccctgatttatggatatacaatcatcaccagtcattatagta |
21774190 |
T |
|
| Q |
194 |
gaatggcttatagtaactccagttgaaaattgcacatttattccatctgtg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21774189 |
gaatggcttatagtaactccagttgaaaattgcacatttattccatctgtg |
21774139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University