View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_48 (Length: 251)
Name: NF3064_low_48
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 40753302 - 40753536
Alignment:
| Q |
11 |
cacagaaaaacgagggtttgtctaatatagacatcccaacaagggtttaaagatggacttttactttattttgaaagaagatggacttttacttttctcc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40753302 |
cacagaaaaacgagggtttgtctaatatagacatcccaacaagggtttaaagatggacttttactttattttgaaaggagatggacttttacttttctct |
40753401 |
T |
 |
| Q |
111 |
agtgtattttgaaaaatattaaatctatttccctttttattattaaaacttatagtttcttatcaaaagtagtaagggtctaccttttatctttgtttcg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40753402 |
ggtgtattttgaaaaatattaaatctatttccctttttattattaaaaattatagtttcttatcaaaagtagtaagggtctaccttttatctttgtttca |
40753501 |
T |
 |
| Q |
211 |
gattagattaagtcttattttctcaatggatcggg |
245 |
Q |
| |
|
|| || ||||||||||||||||| |||||||||| |
|
|
| T |
40753502 |
gactacgttaagtcttattttctcgatggatcggg |
40753536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University