View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_51 (Length: 247)
Name: NF3064_low_51
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_51 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 4 - 247
Target Start/End: Original strand, 2524453 - 2524697
Alignment:
| Q |
4 |
tcgaagaatatcgtgatagaagattcaaccattcaagcaggtaatcaaagtcaaattattttttcttatatataaacactatcaatttaatattttatag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2524453 |
tcgaagaatatcgtgatagaagattcaaccattcaagcaggtaatcaaagtcaaattattttttcttatatataaacactatcaatttaatattttatag |
2524552 |
T |
 |
| Q |
104 |
atgcatctaaaaatgtattctcaacc-aagggttactatgctactaaggatgtttagtcatccataacgttttgagtttaaattccgtcgttagtgtgaa |
202 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
2524553 |
atgcatctaaaaatgtattgtcaaccaaagggttactatgctactaaggatgttgagtcatccataacgttttgagtttaacttccgttgttagtgtgaa |
2524652 |
T |
 |
| Q |
203 |
attagtctacaccacnnnnnnnattgccaaatctcaaatttgtgc |
247 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2524653 |
attagtctacaccactttttttattgccaaatctcaaatttgtgc |
2524697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University