View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_55 (Length: 238)
Name: NF3064_low_55
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 37007076 - 37007297
Alignment:
| Q |
1 |
tgttgggatccacatactgagttcctgctagagcaacattgtcacatgcatataagatgtttagatgataaacaacaatttttataatatgtaatctgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007076 |
tgttgggatccacatactgagttcctgttagagcaacattgtcacatacatataagatgtttagatgataaacaacaatttttataatatgtaatctgaa |
37007175 |
T |
|
| Q |
101 |
ttatgctaaccttgttaggcaagaagctggagttggtaatgatgcaataggcaggtagaagagcataacatatttcagggatagatcttaatgcccaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37007176 |
ttatgctaaccttgttaggcaagaaactggagttggtaatgatgcaataggcaggtagaagagcataacatatttcagggatagatcttaatgcccaatt |
37007275 |
T |
|
| Q |
201 |
agtgatccaaatatatgacaag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37007276 |
agtgatccaaatatatgacaag |
37007297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 117 - 198
Target Start/End: Original strand, 37024043 - 37024124
Alignment:
| Q |
117 |
aggcaagaagctggagttggtaatgatgcaataggcaggtagaagagcataacatatttcagggatagatcttaatgcccaa |
198 |
Q |
| |
|
|||||| ||| ||||||| || | |||||||||||||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37024043 |
aggcaaaaagttggagttagtgagaatgcaataggcaggtagagcagcataacagatttcagggaccgatcttaatgcccaa |
37024124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University