View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3064_low_56 (Length: 238)
Name: NF3064_low_56
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3064_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 28 - 222
Target Start/End: Original strand, 51784862 - 51785056
Alignment:
| Q |
28 |
cgttagtcaaactatctattcagagtacaatacattctcacattcttatatgtcaaattgtgctttattaatacatggtaaaatgaatacttaagtgttg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51784862 |
cgttagtcaaactatctattcagagtacaatacattctcacgttcttatatgtcaaattgtgctttattaatacatggtaaaatgaatacttaagtgttg |
51784961 |
T |
 |
| Q |
128 |
catattattcattcatatattggcatatagatctcttgctgatatgtagatgaatatgttcgaactgacgaaagcacttaatttgagtgcataat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51784962 |
catattattcattcatatattggcatatagatctcttgctgatatgtagatgaatatgttcgaactgacgaaagcacttaagttgagtgcataat |
51785056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University