View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3064_low_59 (Length: 231)

Name: NF3064_low_59
Description: NF3064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3064_low_59
NF3064_low_59
[»] chr7 (1 HSPs)
chr7 (14-215)||(42893941-42894142)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 42894142 - 42893941
Alignment:
14 cagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctgcttgatccattctcagatgaaacacatgaact 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42894142 cagagagcatcacatacatgagacaacgaggacaacctactaacagcatggaggttgcttcagggctgcttgatccattctcagatgaaacacatgaact 42894043  T
114 cggcggcgacaccgacgctgatcgtgttggtgatgattccattcttctgttcacccttggtggtgacaaattcagcttcaaatctagctttggcccactt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42894042 cggcggcgacaccgacgctgatcgtgttggtgatgattccattcttctgttcacccttggtggtgacaaattcagcttcaaatctagctttggcccactt 42893943  T
214 cc 215  Q
    ||    
42893942 cc 42893941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University