View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065-Insertion-11 (Length: 321)
Name: NF3065-Insertion-11
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 7 - 321
Target Start/End: Original strand, 1967919 - 1968233
Alignment:
| Q |
7 |
aacaacaagtgtgaaccaagtagatctcctatgcataatggctatacacattctgcaatatcgttgcatagtaagagatcagattcatctaggaagaata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1967919 |
aacaacaagtgtgaaccaagtagatctcctatgcataatggctatacacattctgcaatatcgttgcatagtaagagatcagattcatctaggaagaata |
1968018 |
T |
|
| Q |
107 |
ttccagagttaaggacacaaaggtctcatttgaatcaagcagcaatagatttctccgattctattaaaaaggaacagggcatgtcaggccgagacaccgg |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1968019 |
ttccagagttaagggcacaaaggtctcatttgaatcaagcagcaatagatttctccgattctattaaaaaggaacagggcatgtcaggccgagacaccgg |
1968118 |
T |
|
| Q |
207 |
aatggtaaacaacaactttctctttactgttatcaactttctatttatcaacttcctcttgnnnnnnnatatggtcaaggtttatttttcttcttgtgag |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1968119 |
aatggtaaacaacaactttctctttactgttatcaactttctatttatcaacttcctcttgtttttttatatggtcaaggtttatttttcttcttgtgag |
1968218 |
T |
|
| Q |
307 |
ttgtgactattttaa |
321 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1968219 |
ttgtgactattttaa |
1968233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University