View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065-Insertion-13 (Length: 131)
Name: NF3065-Insertion-13
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065-Insertion-13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 1807590 - 1807467
Alignment:
| Q |
8 |
gattcaccgtccatcggaagttctcctcttgaaccatcagcagcttctccttcaccatctgatcatccacaacaaccagctgatgaccaacaaagtgtgt |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1807590 |
gattcaccgtccaccggaagttctcctcttgaaccatcagcagcttctccttcaccatctgatcatccacaacaaccagctgatgaccaacaaagtgtgt |
1807491 |
T |
 |
| Q |
108 |
taccatttatacatggcattcaga |
131 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1807490 |
taccatttatacatggcattcaga |
1807467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University