View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065-Insertion-16 (Length: 182)
Name: NF3065-Insertion-16
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065-Insertion-16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 4e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 4e-89
Query Start/End: Original strand, 8 - 181
Target Start/End: Complemental strand, 2485060 - 2484887
Alignment:
| Q |
8 |
gcagataatgctcattcatggtataagggaactgttcctaaattttttaagtctattggcactaactgtagttgttggtaatttttccatgtgacaagag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2485060 |
gcagataatgctcattcatggtataagggaactgttcctaaattttttaagtctattggcactaactttagttgttggtaatttttccatgtgacaagag |
2484961 |
T |
 |
| Q |
108 |
attctattaatcggtatcgtatataaaaatgtaacaccacataagtaacatatttggatcctttacttttttct |
181 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484960 |
attctattaatcggtatcgtatataacaatgtaacaccacataagtaacatatttggatcctttacttttttct |
2484887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University