View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065-Insertion-18 (Length: 95)
Name: NF3065-Insertion-18
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065-Insertion-18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 1e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 1e-38
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 29084440 - 29084524
Alignment:
| Q |
8 |
gtgatagaatccagctgcagcttatcatgtatgttttggtacacaacatcctttgacatagaattctccaacattttgaatctgc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29084440 |
gtgatagaatccagctgcagcttatcatgtatgttttggtacacaacatcctttgacatagaattctccaacatcttgaatctgc |
29084524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 26 - 92
Target Start/End: Original strand, 29087123 - 29087189
Alignment:
| Q |
26 |
agcttatcatgtatgttttggtacacaacatcctttgacatagaattctccaacattttgaatctgc |
92 |
Q |
| |
|
|||||||| |||||||| |||| ||| | ||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
29087123 |
agcttatcttgtatgttgtggtgcacgtcttcctttggcatagaattctccaacatcttgaacctgc |
29087189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University