View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065R-Insertion-5 (Length: 165)
Name: NF3065R-Insertion-5
Description: NF3065R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065R-Insertion-5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 3e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 3e-77
Query Start/End: Original strand, 16 - 165
Target Start/End: Complemental strand, 42701747 - 42701598
Alignment:
| Q |
16 |
acacaaacacttgctggttataacctatcacttttttccttttaaaatcactactaatgtttatgtgacaatatcagtgttgtgtgctgctgctatgtct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42701747 |
acacaaacacttgctggttataacctatcacttttttccttttaaaatcactactaatgtttatgtgccaatatcagtgttgtgtgctgctgctatgtct |
42701648 |
T |
 |
| Q |
116 |
cacagctcacgagtcacaagtttcaaattttttaacgttagtctttctgt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701647 |
cacagctcacgagtcacaagtttcaaattttttaacgttagtctttctgt |
42701598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University