View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065R-Insertion-8 (Length: 223)
Name: NF3065R-Insertion-8
Description: NF3065R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065R-Insertion-8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 43646092 - 43646294
Alignment:
| Q |
9 |
caaagttgaagaaattaattaccccatttggtttattaacacgatgatgaagaaatcacaaacacaaacacaaacactcctcatagttacactgcttcta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43646092 |
caaagttgaagaaattaattaccccatttggtttattaacacgatgatgaagaaatcaca------------aacactcctcatagttacactgcttcta |
43646179 |
T |
 |
| Q |
109 |
accataaacacactctccctctcagcccaaaccatagacaacccatctcttgtctttgaaaacaaccgcatccaaaatgcttacatagcattacaagctc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43646180 |
accataaacacactctccctctcagcccaaaccatagacaacccatctcttgtctttgaaaacaaccgcatccaaaatgcttacatagcattacaagctt |
43646279 |
T |
 |
| Q |
209 |
tgaaacaagccattc |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43646280 |
tgaaacaagccattc |
43646294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University