View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065R-Insertion-9 (Length: 262)
Name: NF3065R-Insertion-9
Description: NF3065R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065R-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 33302783 - 33303035
Alignment:
| Q |
9 |
gtacaaacaatcacttcctagctatctcctttcaatctaatttttcatggcaaatatcaccttaattctcccatttcaaaacacaaccaataattcatat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33302783 |
gtacaaacaatcacttcctagctatctcctttcaatctaatttttcatgacaaatatcaccttaattctcccattgcaaaacacaaccaataattcatat |
33302882 |
T |
|
| Q |
109 |
ttgagaatatcacaaaacaaaccttgaatgacggtnnnnnnntctagtccacccaacacaaccttagagggaataataatagtagtaactattctatcat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33302883 |
ttgagaatatcacaaaacaaaccttgaatgacggt-aaaaaatctagtccacccaacacaaccttagagggaataataatagtagtaactattctatcat |
33302981 |
T |
|
| Q |
209 |
gattactgaagtagaatagaatatatgctatagaacattgtagataaactccac |
262 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33302982 |
gattaatgaagtagaatagaatatatgctatagaacattgtagataagctccac |
33303035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University