View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065_high_26 (Length: 256)
Name: NF3065_high_26
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 11 - 202
Target Start/End: Original strand, 12014528 - 12014719
Alignment:
| Q |
11 |
cacagatgaacataatacttattcatgtaataggaattggtgacatgtcaatcttctattgactcggtacacccaagtcggaaacaccaggcttatacaa |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12014528 |
cacaaatgaacataatacttattcatgtaataggaattggtgacatgtcaatcttctattgactcagtacacccaagtcggaaacaccaggcttatacaa |
12014627 |
T |
|
| Q |
111 |
gaattagtcgagggaacccgtgctcagcacatgttgctggaaataaatttaatgcgaagttaacacgtggtacggcccagattacctaactg |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12014628 |
gaattaatcgagggaacccgtgctcagcacatgttgctggaaataaatttaatgcgaagttaacacgtggtacggcccagattacctaactg |
12014719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University