View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065_low_16 (Length: 330)
Name: NF3065_low_16
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 167 - 322
Target Start/End: Original strand, 41873716 - 41873872
Alignment:
| Q |
167 |
gatagaatcactaactcaagttatttaataag-attcagatgaaatttcatttaaaaataaaataatactattttgttcttacttccaggtataggttaa |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41873716 |
gatagaatcactaactcaagttatttaataaggattcgcatgaaatttcatttaaaaataaaataatactattttgttcttacttccaggtataggttaa |
41873815 |
T |
 |
| Q |
266 |
atacttaattgggcaatcaaaagattcttttctacaaagttgatctaaattcttctc |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41873816 |
atacttaattgggcaatcaaaagattcttttctacaaagttgatctaaattcttctc |
41873872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 41873321 - 41873458
Alignment:
| Q |
18 |
ctatatacgtttttggaatatatatggttatatactagttggagtcaaattcacttatttgatgttcttcggtcccataatataaattatttagcaagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41873321 |
ctatatacgtttttggaatatatatggtta----ctagttggagtcaaattcacttatttgatgttcttcggtcccataatataaatgatttagcaagta |
41873416 |
T |
 |
| Q |
118 |
aattgttttttgacatgtagtatatcgttttgtagtatcaat |
159 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41873417 |
aattgttttttgacatgtagtatgtcgttttgtagtatcaat |
41873458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University