View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3065_low_27 (Length: 256)

Name: NF3065_low_27
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3065_low_27
NF3065_low_27
[»] chr7 (1 HSPs)
chr7 (11-202)||(12014528-12014719)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 11 - 202
Target Start/End: Original strand, 12014528 - 12014719
Alignment:
11 cacagatgaacataatacttattcatgtaataggaattggtgacatgtcaatcttctattgactcggtacacccaagtcggaaacaccaggcttatacaa 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
12014528 cacaaatgaacataatacttattcatgtaataggaattggtgacatgtcaatcttctattgactcagtacacccaagtcggaaacaccaggcttatacaa 12014627  T
111 gaattagtcgagggaacccgtgctcagcacatgttgctggaaataaatttaatgcgaagttaacacgtggtacggcccagattacctaactg 202  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12014628 gaattaatcgagggaacccgtgctcagcacatgttgctggaaataaatttaatgcgaagttaacacgtggtacggcccagattacctaactg 12014719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University