View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065_low_31 (Length: 244)
Name: NF3065_low_31
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065_low_31 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 67 - 244
Target Start/End: Original strand, 7095020 - 7095198
Alignment:
| Q |
67 |
tcaaagtatattgccgacatttttaaacgaggtcatctttctaattatagataatcaaatatccatcgtgagctcaatgtgaagtatgcttcatctaatc |
166 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7095020 |
tcaaagtatattgccgacatttttaaatgaggtcatctttctaattatcgatactcaaatatccctcgtgagctcaatatgaagtatgcttcatctaatc |
7095119 |
T |
 |
| Q |
167 |
gtgtcctttgaaccattattatttatatatttcgatttc-ttgcattatcaagacttttactatctattaaaatactct |
244 |
Q |
| |
|
||||| |||| | |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7095120 |
gtgtcatttggaacattattatttatacatttcgatttcattgcattatcaagacttttactatctattaaaatactct |
7095198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 65
Target Start/End: Original strand, 7092019 - 7092051
Alignment:
| Q |
33 |
agaagtctattgacgttgtctacttctttttca |
65 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
7092019 |
agaagtctattgacgttgtctgcttctttttca |
7092051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University