View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3065_low_38 (Length: 235)
Name: NF3065_low_38
Description: NF3065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3065_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 10 - 113
Target Start/End: Original strand, 8406620 - 8406723
Alignment:
| Q |
10 |
ggagcagagatcaaacaagttgaaatttgaaatgctctctaaggtaaagtgacttcgtttgaaaattaaaattctaaacatgcctatattatatagatgg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
8406620 |
ggagcagagatcaaacaagttgaaatttgaaatgctctctaaggtaaagtgacttcgtttgaaaattaaaattctaaacatgcctgtattatatggatgg |
8406719 |
T |
|
| Q |
110 |
gaaa |
113 |
Q |
| |
|
|||| |
|
|
| T |
8406720 |
gaaa |
8406723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 8416132 - 8416186
Alignment:
| Q |
10 |
ggagcagagatcaaacaagttgaaatttgaaatgctctctaaggtaaagtgacttc |
65 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
8416132 |
ggagcagagatcaaacaagttgaaa-ttgaaatgctctctaaggtaatgtgacttc |
8416186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University