View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3067_high_5 (Length: 285)
Name: NF3067_high_5
Description: NF3067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3067_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 271
Target Start/End: Complemental strand, 14360281 - 14360023
Alignment:
| Q |
13 |
aaggatatggaaccaatatgttgttgttttactgctgaaatgactgatataattttcaatcttgtactgagaatataaaattgactaacaagactcaatt |
112 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| |||| |||||||||||| |||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
14360281 |
aaggatttggaaccaatatgttgtcgttttactgctgaaatgaccgatacaattttcaatctagtactgggaagataaaattgacaaacaagactcaatt |
14360182 |
T |
|
| Q |
113 |
gattagattggttgcaaactgaaatattctttcttcttgaaggcaagctgactgtgcatcagaacattacttttggtaaattgtcattccaatgtttgtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14360181 |
gattagattggttgcaaactgaaatattcttgcttcttgaaggcaagctgactgtgcatcagaacattgcttttggtaaattgtcattccaatgtttgtt |
14360082 |
T |
|
| Q |
213 |
tccagcgtgcttgtcatggacaannnnnnnacaaaatatcaaagaagaaacctggtttt |
271 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14360081 |
ttcagcgtgcttgtcatggacaatttttttacaaaatatcaaagaagaaacctggtttt |
14360023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University