View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3068_high_7 (Length: 248)
Name: NF3068_high_7
Description: NF3068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3068_high_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 33633417 - 33633647
Alignment:
| Q |
18 |
gattgttgcaactaggttttagcagtatcgcaatggtaacgtaattgtaattgcggccaaattgactgttttattcatattttaacataataacaaaatt |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33633417 |
gattgtttcaactaggttttagcagtatcgcaatggtaacgtaattgtaattgcggccaaattgactgttttattcatattttaacataataacaaaatt |
33633516 |
T |
 |
| Q |
118 |
tgcagcttgactcaaaccgcacatcacatcaaaatatgaaatgtacatccagaactaatttatgttaaaaatacatattaaaaattgnnnnnnnnnttac |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33633517 |
tgcagcttgactcaaaccgcacattacatcaaaatatgaaatgtacacccagaactaatttatgttaaaaatacatattaaaaattgaaaaaaaaattac |
33633616 |
T |
 |
| Q |
218 |
gaactaatctgattatttaatcggtgaaaat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33633617 |
gaactaatctgattatttaatcggtgaaaat |
33633647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 248
Target Start/End: Complemental strand, 29192441 - 29192407
Alignment:
| Q |
214 |
ttacgaactaatctgattatttaatcggtgaaaat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
29192441 |
ttacgaactaatctgattatttaatcggtgtaaat |
29192407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 29192528 - 29192467
Alignment:
| Q |
19 |
attgttgcaactaggttttagcagtatcgcaatggtaacgtaattgtaattgcggccaaatt |
80 |
Q |
| |
|
||||||||||||||||||||| ||| | ||| ||||| ||||||| |||| |||||||||| |
|
|
| T |
29192528 |
attgttgcaactaggttttagaagtccctcaacggtaatgtaattgcaattacggccaaatt |
29192467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University