View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3068_low_6 (Length: 322)

Name: NF3068_low_6
Description: NF3068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3068_low_6
NF3068_low_6
[»] chr7 (2 HSPs)
chr7 (7-307)||(38830710-38831010)
chr7 (13-107)||(38862437-38862531)
[»] chr1 (4 HSPs)
chr1 (7-121)||(30623874-30623988)
chr1 (7-121)||(30629505-30629619)
chr1 (53-101)||(30689733-30689781)
chr1 (53-101)||(30718776-30718824)
[»] chr4 (2 HSPs)
chr4 (13-107)||(19719928-19720022)
chr4 (13-106)||(19840571-19840664)
[»] chr2 (1 HSPs)
chr2 (53-95)||(4420155-4420197)


Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 7 - 307
Target Start/End: Original strand, 38830710 - 38831010
Alignment:
7 gcagcagagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38830710 gcagcagagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctt 38830809  T
107 tcttaacacgaggatatagggctatccttaacttctctgagcatgttgtgaaggagtctcttcaaaacatgaattttaatacattgttaaatcgtggttg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  |||||    
38830810 tcttaacacgaggatatagggctatccttaacttctctgagcatgttgtgaaggagtctcttcaaaacatgaattttaagacattgttaaatcaaggttg 38830909  T
207 ctcacctttattggaactaaaaaggatgcatgtgttgagaacaaggtctaagaaccctagtaaaaagggaaaaagggattccaagagcattgtgttgaac 306  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
38830910 ctcacctttattagaactaaaaaggatgcatgtgttgagaacaaggtctaagaaccctagtaaaaagggaaaaagggattccaagagcatggtgttgaac 38831009  T
307 a 307  Q
    |    
38831010 a 38831010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 107
Target Start/End: Original strand, 38862437 - 38862531
Alignment:
13 gagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagcttt 107  Q
    |||||||| ||  |||||||||| |||||| | ||||||||||||||||| || || || ||||||||||||||||||||||| |||||||||||    
38862437 gagataagagattcaacaagaaaaggtgttagagtgtggattggaacattcgacacggccgaagcagctgctttagcttatgatcaagcagcttt 38862531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 30623988 - 30623874
Alignment:
7 gcagcagagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctt 106  Q
    ||||| || ||||| ||| |||||||||| |||||| | || |||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||    
30623988 gcagcggaaataagagactcaacaagaaaaggtgttagagtttggattggtacatttgatacagctgaagctgctgctttagcttatgatcaagcagctt 30623889  T
107 tcttaacacgaggat 121  Q
    | | |||| ||||||    
30623888 tatcaacaagaggat 30623874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 7 - 121
Target Start/End: Complemental strand, 30629619 - 30629505
Alignment:
7 gcagcagagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctt 106  Q
    ||||| || ||||| ||| |||| |||||||||||| | || |||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||    
30629619 gcagcggaaataagagactcaactagaaatggtgttagagtttggattggtacatttgatacagctgaagcagcagctttagcttatgatcaagcagctt 30629520  T
107 tcttaacacgaggat 121  Q
    | | |||| ||||||    
30629519 tatcaacaagaggat 30629505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 30689781 - 30689733
Alignment:
53 ttggaacatttgatacagctgaagcagctgctttagcttatgaccaagc 101  Q
    |||||||||||||||  |||||||  ||||||||||||||||| |||||    
30689781 ttggaacatttgatagtgctgaagatgctgctttagcttatgatcaagc 30689733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 30718824 - 30718776
Alignment:
53 ttggaacatttgatacagctgaagcagctgctttagcttatgaccaagc 101  Q
    |||||||||||||||  |||||||  ||||||||||||||||| |||||    
30718824 ttggaacatttgatagtgctgaagatgctgctttagcttatgatcaagc 30718776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 107
Target Start/End: Complemental strand, 19720022 - 19719928
Alignment:
13 gagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagcttt 107  Q
    |||||||||||| |||||||||| || | | | || ||| ||||||||||  | || || |||| ||||||||||||||| |||||||| |||||    
19720022 gagataagggactcaacaagaaaaggggctagagtatggcttggaacattcaacacggccgaagaagctgctttagcttacgaccaagctgcttt 19719928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 106
Target Start/End: Original strand, 19840571 - 19840664
Alignment:
13 gagataagggacacaacaagaaatggtgttcgtgtgtggattggaacatttgatacagctgaagcagctgctttagcttatgaccaagcagctt 106  Q
    |||||||||||| |||||||||| || | | | || ||| ||||||||||  | || || |||| ||||||||||||||| |||||||| ||||    
19840571 gagataagggactcaacaagaaaaggggctagagtatggcttggaacattcaacacggccgaagaagctgctttagcttacgaccaagccgctt 19840664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 53 - 95
Target Start/End: Complemental strand, 4420197 - 4420155
Alignment:
53 ttggaacatttgatacagctgaagcagctgctttagcttatga 95  Q
    |||| ||||||||||||||||||  ||||||||||||||||||    
4420197 ttggtacatttgatacagctgaacaagctgctttagcttatga 4420155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University