View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3068_low_7 (Length: 249)

Name: NF3068_low_7
Description: NF3068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3068_low_7
NF3068_low_7
[»] chr2 (2 HSPs)
chr2 (148-247)||(33634151-33634250)
chr2 (1-84)||(33634001-33634084)
[»] chr8 (2 HSPs)
chr8 (1-84)||(29191750-29191833)
chr8 (151-247)||(29191578-29191683)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 148 - 247
Target Start/End: Original strand, 33634151 - 33634250
Alignment:
Q  148 tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttttctctcg 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33634151 tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttttctctcg 33634250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 33634001 - 33634084
Alignment:
Q  1 gttgagatcggaggagaatcggaggaaaacggaggtggaggaggagatccatgtgccacgtggaggacggttacggaggcgaac 84  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  33634001 gttgagatcggaggagaatcggaggaaagcggaggtggaggaggagatccatgtgccacgtggaggacggttacggatgcgaac 33634084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 29191833 - 29191750
Alignment:
Q  1 gttgagatcggaggagaatcggaggaaaacggaggtggaggaggagatccatgtgccacgtggaggacggttacggaggcgaac 84  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29191833 gttgagatcggaggagaaacggaggaaagcggaggtggaggaggagatccatgtgccacgtggaggacggttacggaggcgaac 29191750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 151 - 247
Target Start/End: Complemental strand, 29191683 - 29191578
Alignment:
Q  151 tgcgaacgaaatttcccactcgtcactcagtgagtttg---------atcttactgcaactgttcccgccatttgtttgaattatctcttttcttctttt 241  Q
    |||||| |||||||||||||||||||||||||||||||         |||| |||||||||||||||||||||| |||||||| |||| |||| | |||     
T  29191683 tgcgaaggaaatttcccactcgtcactcagtgagtttgttgttgttgatctcactgcaactgttcccgccatttttttgaattctctcctttccttttta 29191584  T
Q  242 ctctcg 247  Q
    ||||||    
T  29191583 ctctcg 29191578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University