View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3068_low_7 (Length: 249)
Name: NF3068_low_7
Description: NF3068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3068_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 148 - 247
Target Start/End: Original strand, 33634151 - 33634250
Alignment:
| Q |
148 |
tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttttctctcg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33634151 |
tcgtgcgaacgaaatttcccactcgtcactcagtgagtttgatcttactgcaactgttcccgccatttgtttgaattatctcttttcttcttttctctcg |
33634250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 33634001 - 33634084
Alignment:
| Q |
1 |
gttgagatcggaggagaatcggaggaaaacggaggtggaggaggagatccatgtgccacgtggaggacggttacggaggcgaac |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33634001 |
gttgagatcggaggagaatcggaggaaagcggaggtggaggaggagatccatgtgccacgtggaggacggttacggatgcgaac |
33634084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 29191833 - 29191750
Alignment:
| Q |
1 |
gttgagatcggaggagaatcggaggaaaacggaggtggaggaggagatccatgtgccacgtggaggacggttacggaggcgaac |
84 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29191833 |
gttgagatcggaggagaaacggaggaaagcggaggtggaggaggagatccatgtgccacgtggaggacggttacggaggcgaac |
29191750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 151 - 247
Target Start/End: Complemental strand, 29191683 - 29191578
Alignment:
| Q |
151 |
tgcgaacgaaatttcccactcgtcactcagtgagtttg---------atcttactgcaactgttcccgccatttgtttgaattatctcttttcttctttt |
241 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||| |||| |||| | ||| |
|
|
| T |
29191683 |
tgcgaaggaaatttcccactcgtcactcagtgagtttgttgttgttgatctcactgcaactgttcccgccatttttttgaattctctcctttccttttta |
29191584 |
T |
 |
| Q |
242 |
ctctcg |
247 |
Q |
| |
|
|||||| |
|
|
| T |
29191583 |
ctctcg |
29191578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University