View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_high_43 (Length: 360)
Name: NF3069_high_43
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_high_43 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 19 - 360
Target Start/End: Original strand, 26775415 - 26775750
Alignment:
| Q |
19 |
actcatacaaaccttttcccaatctctcttatattgcgcaattgtggaacactattctgattactcatacaaaccttttcccttttagtcttttggttgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26775415 |
actcatacaaaccttttcccaatctctcttatattgcgcaattgtggaacactattctgattactcatacaaaccttttcccttttagtctcttggttgc |
26775514 |
T |
|
| Q |
119 |
gcaatatcttaactgctaaaccctccaaagattgcgcaatatcagttttatatattaaatgaatttgacatgtcatcaatccgtgtgatc-aactctgct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26775515 |
gcaatatcttaactgctaaaccctccaaagattgcgcaatatcagttttatatattaaatgaatttgacatctcatcaatccgtgtgatcaaactctgct |
26775614 |
T |
|
| Q |
218 |
atgccatgtcatcaatccgcaaaataaaaagtaccacaaacaataggggaattannnnnnngacaggagctaacaataagtaactaacaacggtaatagt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
26775615 |
atgccatgtcatcaatccgcaaaataaaaagtaccacaaacaataggggaattatttttttgacaggagctaacaataagtaactaataacggta----- |
26775709 |
T |
|
| Q |
318 |
ctatagtctatttatataataatgaatgaaagctttattcaac |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26775710 |
--atagtctatttatataataatgaatgaaagctttattcaac |
26775750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 64 - 100
Target Start/End: Original strand, 26775398 - 26775434
Alignment:
| Q |
64 |
ggaacactattctgattactcatacaaaccttttccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26775398 |
ggaacactattctgattactcatacaaaccttttccc |
26775434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University