View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_high_59 (Length: 296)
Name: NF3069_high_59
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_high_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 89 - 292
Target Start/End: Complemental strand, 36888031 - 36887832
Alignment:
| Q |
89 |
gcaagaaacaacacattgtaattctacatttgcttctcaacttcgaaaaccaatgaaaacgcaaagaaaattcactgatgctatctctctgtgtattttt |
188 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
36888031 |
gcaagaaactacacatggtaattctacatttgcttctcaacttcgaaaaccgatgaaaacgcaatgaaaattcacttatgctatttctctgtgta-tttt |
36887933 |
T |
 |
| Q |
189 |
caggaaaagaagaacaaagagtattgttaatagtttcttccaattctcagaaaaatgattcgtaacttcctttacctgcttctcaatctggttctctgct |
288 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36887932 |
caggaaaagaagaacaaagagcattgttaatagt---ttccaattctcagaaaaatgattcgtaacttcctttacctgcttctcaatctggttctcttct |
36887836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University