View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_high_66 (Length: 268)
Name: NF3069_high_66
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_high_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 86 - 250
Target Start/End: Complemental strand, 3429837 - 3429672
Alignment:
| Q |
86 |
acacatcgattggggg-ttttgcttggttccacgtggagtttgatagatttctttcatttaaggcaatggatattagagattgcgtgaaacagaaaaaga |
184 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429837 |
acacatcgattggggggttttgcttggttccacgtggagtttgatagatttctttcatttaaggcaatggatattagagattgcgtgaaacagaaaaaga |
3429738 |
T |
|
| Q |
185 |
aaaagatgtttggtataaattaactgactttgtttcatgaatgatgatgatgtattcccaaaatgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429737 |
aaaagatgtttggtataaattaactgactttgtttcatgaatgatgatgatgtattcccaaaatgt |
3429672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University