View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_high_89 (Length: 237)
Name: NF3069_high_89
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_high_89 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 41987458 - 41987687
Alignment:
| Q |
1 |
cttccttttcagatatgatgatgtaccagagctgtatatcatgagcgtacaaactccatctgcataagctgtgtcaattgcaagttgcaaccgcactttc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41987458 |
cttccttttcagatacgatgatgtaccagagttgtatatcatgagcgtacaaactccatctgcataagctgtgtcaattgcaagttgcaactgcactttc |
41987557 |
T |
|
| Q |
101 |
ctcagtcctctggctatggcccaggttcaacatttctcataactagccactgttcactagaatctagatatataacttcttttgttaatcaatacaaaaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41987558 |
ctcagtcctatggctatggcccaggttcaacatttctcataactagccacggttcactagaatctagatatataacttcttttgttaatcaatacaaaaa |
41987657 |
T |
|
| Q |
201 |
atattcctttctcatacagtgatgatgtcc |
230 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
41987658 |
atattcctttctcatacagtgatgttgtcc |
41987687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 104
Target Start/End: Original strand, 41984934 - 41985002
Alignment:
| Q |
36 |
atatcatgagcgtacaaactccatctgcataagctgtgtcaattgcaagttgcaaccgcactttcctca |
104 |
Q |
| |
|
|||| |||||| || ||| |||||||||||| | |||||||||||||||||| ||| | |||||||||| |
|
|
| T |
41984934 |
atatgatgagcatagaaattccatctgcatatgttgtgtcaattgcaagttgtaactgtactttcctca |
41985002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 229
Target Start/End: Original strand, 41985019 - 41985059
Alignment:
| Q |
189 |
tcaatacaaaaaatattcctttctcatacagtgatgatgtc |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
41985019 |
tcaatacaaaaaatattcctttgtcatacagtgatgttgtc |
41985059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University