View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3069_low_101 (Length: 233)

Name: NF3069_low_101
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3069_low_101
NF3069_low_101
[»] chr3 (2 HSPs)
chr3 (10-94)||(53721446-53721530)
chr3 (164-215)||(53721601-53721652)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 53721446 - 53721530
Alignment:
10 agcataggcagaaagcgacnnnnnnnatctgatttcaccatccatctttttagcaaggaaattctatgaggatcctgattcctgc 94  Q
    |||| ||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53721446 agcagaggcagaaagcgactttttttatctgatttcaccatccatctttttagcaaggaaattctatgaggatcctgattcctgc 53721530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 53721601 - 53721652
Alignment:
164 gtatgcatacccgtgtctctcagtaatccacaggagtttggcatggcagcta 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
53721601 gtatgcatacccgtgtctctcagtaatccacaggagtttggcatggcagcta 53721652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University