View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_101 (Length: 233)
Name: NF3069_low_101
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_101 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 94
Target Start/End: Original strand, 53721446 - 53721530
Alignment:
| Q |
10 |
agcataggcagaaagcgacnnnnnnnatctgatttcaccatccatctttttagcaaggaaattctatgaggatcctgattcctgc |
94 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721446 |
agcagaggcagaaagcgactttttttatctgatttcaccatccatctttttagcaaggaaattctatgaggatcctgattcctgc |
53721530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 53721601 - 53721652
Alignment:
| Q |
164 |
gtatgcatacccgtgtctctcagtaatccacaggagtttggcatggcagcta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721601 |
gtatgcatacccgtgtctctcagtaatccacaggagtttggcatggcagcta |
53721652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University