View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_102 (Length: 231)
Name: NF3069_low_102
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_102 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 103 - 218
Target Start/End: Original strand, 51761514 - 51761629
Alignment:
| Q |
103 |
ttcctctaatttcttaatccttttgttcttcttttctttgtgatataaacaaaaaatgatgcaaacacataactccctcacactccttgctttcttcatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51761514 |
ttcctctaatttcttaatccttttgttcttcttttctttgtgatataaacaaaaaatgatgcaaacacataactccctcacactccatgctttcttcatg |
51761613 |
T |
|
| Q |
203 |
atcttgttcatctcac |
218 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
51761614 |
atcttgttcatgtcac |
51761629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 47 - 83
Target Start/End: Original strand, 51761463 - 51761499
Alignment:
| Q |
47 |
catcaccccttactctactcaatcacactcactctta |
83 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
51761463 |
catctccccttactctactgaatcacactcactctta |
51761499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University