View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_111 (Length: 205)
Name: NF3069_low_111
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_111 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 5e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 122 - 188
Target Start/End: Complemental strand, 31032883 - 31032816
Alignment:
| Q |
122 |
tcaactgttaagaaattaaagag-tactgaaatatttaacttgagttaattgtcaattgctcatggtt |
188 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31032883 |
tcaactgtcaagaaattaaagaggtactaaaatatttaacttgagttaattgtcaattgctcatggtt |
31032816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 144 - 189
Target Start/End: Complemental strand, 31022971 - 31022926
Alignment:
| Q |
144 |
gtactgaaatatttaacttgagttaattgtcaattgctcatggttt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31022971 |
gtactgaaatatttaacttgagttaattgtcaattgctcatggttt |
31022926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University