View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_112 (Length: 201)
Name: NF3069_low_112
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_112 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 182
Target Start/End: Original strand, 42910353 - 42910518
Alignment:
| Q |
17 |
gatgaaatcccaaacctattatgataaacaaattaatgtatcatcttcattaaaccattgcacatgaaaattttacaagattcttaatacataatctaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910353 |
gatgaaatcccaaacctattatgataaacaaattaatgtatcatcttcattaaaccattgcacatgaaaattttacaagattcttaatacataatctaat |
42910452 |
T |
|
| Q |
117 |
attgatcaccttgcatgttccgtcaagagagcttgatattaaaattgaaaagcaactgcaagttgt |
182 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42910453 |
attgattaccttgcatgttccatcaagagagcttgatattaaaattgaaaagcaactgcaagttgt |
42910518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University