View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_28 (Length: 434)
Name: NF3069_low_28
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 3823054 - 3822913
Alignment:
| Q |
275 |
aacgttgcaacactgtatgtgatttcaaagttaaaaattgtttcactcaaaaattaaatttgagattcttccgaacaattgcccttaagtgaagtttatt |
374 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3823054 |
aacgttgcaacactatatgtgatttcaaagttaaagattgtttcactcaaaaattaaatttgagattcttccgaacgattgcccttaagtgaagtttatt |
3822955 |
T |
|
| Q |
375 |
aacaaattgaactcatcatttgactagtgaaatacctcatct |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822954 |
aacaaattgaactcatcatttgactagtgaaatacctcatct |
3822913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 10 - 145
Target Start/End: Complemental strand, 3823326 - 3823191
Alignment:
| Q |
10 |
tgagatgaactaaacataaggtgaatcaccaattcgattgttgaaattgtatggattgaacaatctaaaatggcgaaaataccattaactcgttttcaaa |
109 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3823326 |
tgagatgaaccaaacataaggtgaatcaccaatttgattgttgaaattgtatggatcgaacaatctaaaatggcgaaaataccattaactcattttcaaa |
3823227 |
T |
|
| Q |
110 |
ttttcaaccattatcctttctcctccactcctctcc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823226 |
ttttcaaccattatcctttctcctccactcctctcc |
3823191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University