View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_37 (Length: 391)
Name: NF3069_low_37
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 178 - 347
Target Start/End: Original strand, 13585147 - 13585312
Alignment:
| Q |
178 |
caagttgactcaaaacggtattgatgttccttgtattgatcagttaagggaagagctttcttgcgcagtaagagtttgtttcttgttccctttggtttaa |
277 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13585147 |
caagttgactcaaaacggcattgatgttccttgtattgatcagttaagggaagagctttcttgcgcagtaagagtttgtttcttgttccctttggtttaa |
13585246 |
T |
 |
| Q |
278 |
tgcctttgnnnnnnnnnatctaagaagcactgacaccagacacagatatggacactgacatgccgacaca |
347 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
13585247 |
tgcctttg---ttttttatctaagaagcacggacaccagacac-gatattgacactgacatgccgacaca |
13585312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 20 - 114
Target Start/End: Original strand, 13584989 - 13585083
Alignment:
| Q |
20 |
aagagaactgatatgacaatgatgagtttgatgttctctatttttccacatgtcctttatttgttctatgatgttattcctacctttggtggtgc |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13584989 |
aagagaactggtatgacaatgatgagtttgatgttctccatttttccacatgtcctttatttattctatgatgttattcctacctttggtggtgc |
13585083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University