View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_44 (Length: 364)
Name: NF3069_low_44
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 37 - 350
Target Start/End: Original strand, 8793630 - 8793944
Alignment:
| Q |
37 |
tccattcttaacatcatagtactaaataaattgagatgcatttaagaggtcgatatctctcaacatgattttttatatacaatannnnnnn-atcagtta |
135 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
8793630 |
tccactcttaacatcatagtactaaataaattgagatacatttaagaggtcgatatctctcaacatgattttttatatataatattttttttatcagtta |
8793729 |
T |
 |
| Q |
136 |
tactctttctctatcaattactttataattatttaaagacaggagtatatgtttaaaatttgcttattaatcaaaacatannnnnnnggaaaaacaatct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8793730 |
tactctttctctatcaattactttataattattaaaagacaagagtatatgtttaaaatttgcttattaatcaaaacatatttttttggaaaaacaatct |
8793829 |
T |
 |
| Q |
236 |
attaagtacatagcaacatagagagtatactttgcaagagcgatataatggttggttgttcaggtgtttgacctttcgttcattcactggacatttgaat |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8793830 |
attaagtacatagcaacatagagagtatactttgcaagagccatataatggttgtttgttcaggtgtttgacctttcgttcattcactggacatttgaat |
8793929 |
T |
 |
| Q |
336 |
tgtgaagtagctact |
350 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8793930 |
tgtgaagtagctact |
8793944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University