View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_55 (Length: 326)
Name: NF3069_low_55
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 276
Target Start/End: Original strand, 45362823 - 45363087
Alignment:
| Q |
12 |
agagaggggaggaaggtggagcaaaaacgatgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaa |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362823 |
agagaggggaggaaggtggggcaaaaacgatgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaa |
45362922 |
T |
 |
| Q |
112 |
cacatattcgagcattatcggcctaacttggtcactcatttcattcaggtggaatattgaaatgcctgttatcatagaaaagtctatttccatattgtca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45362923 |
cacatattcgagcattatcggcctaacttggtcactcatttcattcaggtggaatattgaaatgcctgttatcatagcaaagtctatttccatattgtcg |
45363022 |
T |
 |
| Q |
212 |
gatgcagggcttggcatggccatgtacagtcttggttagtattcaatcaaactcaatggtgttta |
276 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45363023 |
gatgcagggcttggcatggccatgttcagtcttggttagtattcaataaaactcaatggtgttta |
45363087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 41 - 161
Target Start/End: Original strand, 25040218 - 25040338
Alignment:
| Q |
41 |
atgccaccagcaagtataatgacgaggctgatattgataatggtttggagaaaacttatcagaaacccaaacacatattcgagcattatcggcctaactt |
140 |
Q |
| |
|
||||||||||| ||| | ||||| ||||| |||||||| |||||||||||||||||||||||||| |||||||| ||||| ||| | || || || |||| |
|
|
| T |
25040218 |
atgccaccagctagtgtgatgacaaggcttatattgattatggtttggagaaaacttatcagaaatccaaacacttattctagcttaattggtctcactt |
25040317 |
T |
 |
| Q |
141 |
ggtcactcatttcattcaggt |
161 |
Q |
| |
|
|||| | |||||||||||| |
|
|
| T |
25040318 |
ggtctttggtttcattcaggt |
25040338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 165 - 247
Target Start/End: Original strand, 25040700 - 25040782
Alignment:
| Q |
165 |
atattgaaatgcctgttatcatagaaaagtctatttccatattgtcagatgcagggcttggcatggccatgtacagtcttggt |
247 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||||||| ||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
25040700 |
atattgaaatgcctgccattatagcaaagtctatttccattctgtcagatgcaggacttggcatggctatgttcagtcttggt |
25040782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University