View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_59 (Length: 306)
Name: NF3069_low_59
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 293
Target Start/End: Original strand, 43382300 - 43382564
Alignment:
| Q |
8 |
ttgtctgtaattacaaacaaatcaaacattttatatcttttggtcattattatatttttaatcagattttgtagaaacttcaatttgaaggataaaactt |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43382300 |
ttgtctgtaattacaaacaaatcagacattttatatcttttggtcattattatatttttaatcagattttgtagaaac--------------------tt |
43382379 |
T |
 |
| Q |
108 |
caacttgagcatgttgacaaatgtagataacttttgaatattacttgttcacaccaacacatagattgtagaactatttgtactcttaaaatggtatgac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43382380 |
caacttgagcatgttgacaaatgtagataacttttgaatattacttgttcacaccaacacattgattgtagaactatttgtactcttaaaatggtatgac |
43382479 |
T |
 |
| Q |
208 |
tgtacgaccctaccctaccccgtttgagaataagattttaccacactcatatactagttattctgtatttttctcatatcttacat |
293 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43382480 |
tgtacgaccctaccctatcccgtttgaaaataagattttaccacactcatatactagttattctgta-ttttctcatatcttacat |
43382564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University