View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_78 (Length: 259)
Name: NF3069_low_78
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 31581008 - 31580848
Alignment:
| Q |
1 |
tcattgtggaagggtggtgaccaattgagatttttccgcgctgatttgcacgaagaaggaagtttcgaggaggcagtaaaaggatgtgatggtgttttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31581008 |
tcattgtggaagggtggtgaccaattgagatttttccgcgctgatttgcacgaagaaggaagtttcgaggaggcagtaaaaggatgtgatggtgtgttcc |
31580909 |
T |
 |
| Q |
101 |
atgttgcagcttcaatgcagttcaatgttaatgagaaagaaaacattggtaatacaatgca |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31580908 |
atgttgcagcttcaatgcagttcaatgttaatgagaaagaaaacattggtaatgcaatgca |
31580848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 213 - 252
Target Start/End: Complemental strand, 31580801 - 31580762
Alignment:
| Q |
213 |
tgtgcattgataactaacagatatttgatatttcatctct |
252 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
31580801 |
tgtgcattggtaactaacagatttttgatatttcatctct |
31580762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University