View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_79 (Length: 254)
Name: NF3069_low_79
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_79 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 42345333 - 42345099
Alignment:
| Q |
18 |
agatagtcaaatagtttgattcgacctagcttcgacattaattgcagtcactttacgattgtggagacaaaaaattatgatgttgcggtctaaattgcgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
42345333 |
agatagtcaaatagtttgattcgaccttgcttcgacattaattgcagtcactttacgattgtggagacaaaa--ttatgatgttgcagtctaaattgcgg |
42345236 |
T |
|
| Q |
118 |
tgtttgtcattttttaaaatccttccacgatccttcattttatagtttattccgtgtcaaagaaaaattggggctggggcttatgagctgttgatattca |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42345235 |
tgttcgtcattttttaaaatccttccacaatccttcattttatagtttattccgtgtcaaagaaaaaggggggctggggcttatgagctgttgatattca |
42345136 |
T |
|
| Q |
218 |
cgttgctttttactgcttcactataccaataacatat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42345135 |
cgttgctttttactgcttcactataccaataacatat |
42345099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University