View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_81 (Length: 253)
Name: NF3069_low_81
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 34340106 - 34340327
Alignment:
| Q |
19 |
agaactccgaccagtgcctctactgaaatcatcaaattggtgactctgttcagcatcactgagtttttctacttgtccagcttttgttggagtctcaacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340106 |
agaactccgaccagtgcctctactgaaatcatcaaattggtgactctgttcagcatcactgagtttttctacttgtccagcttttgttggagtctcaacc |
34340205 |
T |
 |
| Q |
119 |
tgctcattcttagaatgatagaatacagatgaaaatattgtatctcaacttgtttgtctagaattgttcacaaactttcttaaaattaactgtaattatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340206 |
tgctcattcttagaatgatagaatacagatgaaaatattgtatctcaacttgtttgtctagaattgttcacaaactttcttaaaattaactgtaattatg |
34340305 |
T |
 |
| Q |
219 |
agtatatctatgacttcttctc |
240 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
34340306 |
agtatatctatgactttttctc |
34340327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University