View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_82 (Length: 251)
Name: NF3069_low_82
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 46 - 160
Target Start/End: Complemental strand, 30682001 - 30681884
Alignment:
| Q |
46 |
attggaaacaagtaaagtggttg---aacaagtacttagtatttgtacgttttatttgtgaactttgactcataaattagctactaagtcactgttatgt |
142 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30682001 |
attggaaacaagtaaagtggttgttgaataagtacttagtatttgtacgttttatttgtggactttgactcataaattagctactaagtcactgttatgt |
30681902 |
T |
 |
| Q |
143 |
gaaagattcaataagttg |
160 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30681901 |
gaaagattcaataagttg |
30681884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 237
Target Start/End: Complemental strand, 30681840 - 30681807
Alignment:
| Q |
204 |
ctttccataattgaggttgttggattcaactttc |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
30681840 |
ctttgcataattgaggttgttggattcaactttc |
30681807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University