View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3069_low_86 (Length: 249)
Name: NF3069_low_86
Description: NF3069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3069_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 236
Target Start/End: Original strand, 14054039 - 14054254
Alignment:
| Q |
21 |
tattgcggaaaaagagaagtaagatggtgacaagacgaacaaaaagaatgggacgaccgtgatttgcatatttctacattcttctgcagcttttttctct |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14054039 |
tattgcggaaaaagagaagtaagatggtgacaagacaaacaaaaagaatgggacgaccgtgatttgcatatttctacattcttctgcagcttttttctct |
14054138 |
T |
 |
| Q |
121 |
catgctatagtacatgaatacgtagtatatacactgaaaactgttgccctagaattcagctggcttctcggaacaccactatcaggtccaatataatcca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
14054139 |
catgctatagtacatgaatacgtagtatatacactgaaaactgttgccctagaattcagcttgcttctcgggacaccactatcaggtccaatataattca |
14054238 |
T |
 |
| Q |
221 |
tcaatacaaacaatat |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14054239 |
tcaatacaaacaatat |
14054254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University